
Course Homepage
Sept 2018
This project is maintained by BIG-SA
Before we move on to sequencing technologies, let’s have look at a few important file types & methods that you’re likely to come across.
Later today we’ll use a genome broswer running on our local machines (IGV), but a good one to start with is the web-based UCSC browser. Click this link and you should see a slightly intimidating screen full of information. You’ll be able to see:
Once you’ve got a handle on what’s there, locate the hide all button and click that, which will just give the genomic region with no track information.
We can turn on a huge variety of “tracks” which contain genomic informationthat we may care about.
Let’s start by turning on the GENCODE transcripts again.
Under the Genes and Gene Predictions section, find the GENCODE v24 drop-down menu and click the arrow next to the word ‘hide’.
Change this to ‘full’ and hit one of the refresh button you can see scattered across the page.
Now the transcripts will appear again in a less cluttered display.
Under the hood, the browser has used this information saved as a BED file, which enables us to define genomic regions in a conventient tab-delimited format.
We’ll look at these in more detail soon.
As well as showing the transcript structure, we can also show simple genomic features like a SNP, so let’s look for the Variation region down the page a little, then set the Common SNPs(150) track to full as well. To make these changes appear, hit a refresh button again and the browser will now have this track showing. This is pretty crazy, so we can condense this using the pack option. Try this then the dense and squish options to see what difference they all make.
If you haven’t already tried it, you can click on any of the genomic features and you’ll be taken to a page containing all the key information about that feature. You can also drag your mouse over regions to zoom in, and can zoom out using the buttons at the top of the page. Type the name of your favourite gene into the search box and you’ll be able to find your way to that. If you can’t think of one, just enter IL2RA and you’ll be taken to a page full of choices. As we’re using GENCODE 24, look for that list about half way down and select one of the isoforms you can see. This will take you back to the browser, but just showing the region for the selected transcript.
Now we’ve had a brief exploration of the browser, let’s look at some file types which will enable us to upload custom features, and which are useful an numerous stages during analysis using NGS data.
These are a common file type for uploading your own data to the UCSC browser if you’d like to add a custom track with your own genomic features, and can also be imported into the IGV browser which we’ll explore later in the session. This format is best used for genomic regions which all represent the same type of feature (e.g. genes, promoters, sequence motifs etc). They’re also able to be used as input for numerous analytic tools, so are very useful to know about. A full description of the format is available at: https://genome.ucsc.edu/FAQ/FAQformat.html#format1
BED files are also very commonly used for interacting with a variety of NGS-related tools.
We can use these to just obtain a subset of alignments from a larger file, to restrict variant calling to specific regions, etc..
The basic structure is a tab-separated file, with a minimum of three mandatory columns giving the Chromosome (chrom), start (chromStart) and end (chromEnd) positions.
In this way we can simply define genomic regions of interest that we have found in our analysis, and can visualise them.
As with the vast majority of the file types we’ll come across, each line needs to have the same number of fields, with the exception of any header lines.
Unlike other file types, header lines in bed files do not start with a comment character but can only begin with the words browser or track.
Let’s start by forming our own bed file.
cd ~
touch gk.bed
The following two regions were obtained as enriched for FOXP3 binding within the gene GK1.
Now we’ve created an empty file (touch gk.bed) we can place our two important binding sites inside this file.
You can use the text editor gedit (gedit gk.bed &), which we have installed on your VMs to do this, or nano (nano gk.bed) if you prefer working in the terminal environment.
track name="FOXP3 sites"
chrX 30671901 30672803
chrX 30691567 30692445
hg38 genome build.Position/Search Term text box, then just click on any of the links returned by the search.hide all and click it.Genes and Gene Predictions, find GENCODE v24 and select full using the drop-down menuThis should just give you a generic view of the gene GK.
Now we have this view:
manage custom tracks button directly below the browser.gk.bed and follow the link chrXThis will give a additional track on the browser which shows these two regions.
In addition to the mandatory columns, there are 9 optional fields which are able to be added. The order of these is fixed and these are:
name: The name of the ‘feature’score: An integer between 0 and 1000. This can be used to control the the darkness of the greyscale for each region.strand: Can only take the values ‘.’, ‘+’ or ‘-‘thickStart: If you wish to have a feature with thick & thin sections, such as exons & introns, this sets these valuesthickEnd: Same as above…itemRGB: Set the colour of the feature in RGB format. This must be three integers between 0 and 255, separated by commas. These correspond directly to the amount of red, green or blue so 255,0,0 would correspond to red at maximum, with blue and green off. This also requires itemRgb="On" to be supplied in the header line.blockCount, blockSizes and blockStarts: These are used to define exons (or other sub-regions) within a larger region.Let’s add some colours to our two FOXP3 regions.
browser position chrX:30671000-30693000
track name="FOXP3 sites" itemRgb="On"
chrX 30671901 30672803 Site1 0 . 30671901 30672803 255,0,0
chrX 30691567 30692445 Site2 0 . 30691567 30692445 0,0,255
Once you’ve uploaded this, right-click the track on the browser and make sure that you have the track set to full.
Notice that we didn’t bother with the final three columns.
There can be a little confusion about GFF and GTF files and these share some similarities with BED files. GFF (General Feature Format) files have version2 and version3 formats, which are slightly different. Today, we’ll just look at GTF (General Transfer Format) files, which are best considered as GFF2.2, as restrictions are placed on the type of entries that can be placed in some columns.
Whilst BED files are generally for showing all the locations of a single type of feature, multiple feature types can be specified within one of these files. Again, like BED files, fields are tab-separated with no line provided which gives the column names. These are fixed by design, and as such are not required.
Notice that there’s no real way to represent our FOXP3 sites as a GTF file!
This format is really designed for gene-centric features as seen in the 3rd column.
An example is given below.
Also note that header rows are not controlled, but must start with the comment character #
# Data taken from http://mblab.wustl.edu/GTF22.html
381 Twinscan CDS 380 401 . + 0 gene_id "001"; transcript_id "001.1";
381 Twinscan CDS 501 650 . + 2 gene_id "001"; transcript_id "001.1";
381 Twinscan CDS 700 707 . + 2 gene_id "001"; transcript_id "001.1";
381 Twinscan start_codon 380 382 . + 0 gene_id "001"; transcript_id "001.1";
381 Twinscan stop_codon 708 710 . + 0 gene_id "001"; transcript_id "001.1";
The most hated format is a VCF file, which stands for Variant Call Format, but is more accurately known as Very Confusing Format.
Again, the general structure is header rows (beginning with the double comment symbol ##), followed by tab-separated columns with the actual data.
In this case, column names are provided directly about the data in a line starting with a single comment character (#).
Whilst a flexible format, it is heavily structured with abbreviations and symbols with important meaning, e.g. phased genotypes are separated by |, whilst unphased ones are separated by /.
The example is taken from the file specification at https://samtools.github.io/hts-specs/VCFv4.2.pdf, and we could spend an enormous amount of time unpacking this example.
Important things to note are:
FORMAT column defines the format of subsequent columnsFORMAT columnMost of us have seen these, and the basic format is very simple.
Information about a sequence is placed after a > symbol, and these can occur throughout the file, indicating the start of a new sequence.
Following these lines are simple sequence data to a width of either 70 or 80 characters.
Sequence data can be DNA, RNA or Amino Acid data
>HSGLTH1 Human theta 1-globin gene fragment
CCACTGCACTCACCGCACCCGGCCAATTTTTGTGTTTTTAGTAGAGACTAAATACCATATAGTGAACACCTAAGA
CGGGGGGCCTTGGATCCAGGGCGATTCAGAGGGCCCCGGTCGGAGCTGTCGGAGATTGAGCGCGCGCGGTCCCGG
GATCTCCGACGAGGCCCTGGACCCCCGGGCGGCGAAGCTGCGGCGCGGCGCCCCCTGGAGGCCGCGGGACCCCTG
GCCGGTCCGCGCAGGCGCAGCGGGGTCGCAGGGCGCGGCGGGTTCCAGCGCGGGGATGGCGCTGTCCGCGGAGGA
CCGGGCGCTGGTGCGCGCCCTGTGGAAGAA
This is the format genomes are provided in by all genomic repositories such as Ensembl, NCBI and the UCSC. Each chromosome is specified by the header, with the entire sequence following.
These are the extension of fasta files which we usually obtain as output from our sequencing runs. We’ll spend some time exploring these later today.
These are plain text Sequence AlignMent files, which we will also spend some time looking at later today. The binary version of a SAM file is known as a BAM file, and is the plain text information converted to the more computer-friendly binary format. This usually results in a size reduction of around 5-10 fold, and BAM files are able to be processed much more quickly by NGS tools. We’ll also have a good look at these during the course of the day.